Dziedziczna ogólnoustrojowa amyloidoza z powodu wariantu Asp76As 2-Microglobulin AD 3

Ciężka autonomiczna neuropatia została potwierdzona w probandzie (członek rodziny II-7) oraz w jej młodszej siostrze (członek rodziny II-9) za pomocą specjalistycznych testów funkcjonalnych. Badanie przeprowadzono zgodnie z Deklaracją Helsińską. Wszyscy autorzy gwarantują kompletność i dokładność analiz i wyników. Zarówno pacjenci, jak i członkowie rodziny, których nie dotknęło, wyrazili na piśmie świadomą zgodę.
Metody
Analiza histologiczna i proteomiczna
Amyloidę wykryto przez czerwone zabarwienie Kongo na odcinkach utrwalonych w formalinie, woskowych próbek do biopsji. Barwienie immunohistochemiczne przeprowadzono z użyciem przeciwciał monoklonalnych przeciwko białku surowicy amyloidu A, łańcuchów lekkich immunoglobulin kappa i lambda, transtyretyny, fibrynogenu, apolipoproteiny AI, lizozymu i .2-mikroglobuliny.4 Poliklonalne królicze przeciwciało anty-.2-mikroglobulina i sprzężone ze złotem kozie anty-antygrawowe IgG zostały użyte do mikroskopii immunoelektronowej.5 Włókna amyloidowe ekstrahowano6 ze śledziony starszej siostry probanda (członek rodziny II-1), jak również z próbek biopsyjnych utrwalonych w formalinie i na sercu za pomocą laserowej mikrodysekcji. Białko amyloidu analizowano za pomocą tandemowej spektrometrii masowej.7
Rekombinowane typu dzikiego i wariant białka .2-mikroglobuliny ulegały ekspresji i oczyszczeniu.8 Zestaw do mutagenezy ukierunkowanej QuickChange (Stratagene) i sekwencję starterów CACCCCCACTGAAAAAAATGAGTATGCCTGCC zastosowano do mutagenezy asparaginianu w pozycji 76 (Asp76) do asparaginy (Asn).
Prążki żelu obu rekombinowanych i wyekstrahowanych białek włókienek trawiono oddzielnie AspN i trypsyną. Sekwencyjne trawienie AspN, a następnie trypsyną potwierdziło, że dwie izoformy są rozróżnialne przez analizę peptydów tryptycznych. AspN rozszczepia się tylko wtedy, gdy asparaginian występuje w pozycji 76; w obecności asparaginy w pozycji 76, nieprzecięty peptyd, który nie jest uwalniany z żelu akryloamidowego, jest rozszczepiany przez trypsynę do peptydów, które można zidentyfikować za pomocą spektrometrii masowej.
Molekularna analiza genetyczna
Gen .2-mikroglobuliny został zsekwencjonowany we wszystkich dostępnych członkach rodziny.9 Nazewnictwo mutacji było oparte na transkrypcie .2-mikroglobuliny (numer referencyjny Narodowego Centrum Informacji o Biotechnologii [NCBI], numer uzupełniający DNA [cDNA], NM_004048). Nukleotydy numerowano zgodnie z cDNA, z +1 odpowiadającym A kodonu inicjacji translacji ATG, zgodnie z wytycznymi Human Genome Variation Society (www.hgvs.org/mutnomen). Wariantowa nomenklatura białka nie zawiera peptydu sygnałowego o 20 aminokwasach.
Badania obrazowania klinicznego
Obrazowanie scyntygraficzne przedniego i tylnego przedniego całego ciała wykonano 24 godziny po podaniu wyznakowanego jodem-123 składnika amyloidu P surowicy (123I-SAP) w członków rodziny II-7 i II-9.10
Badania białek
Stabilność białka określono przez emisję fluorescencji po inkubacji z chlorowodorkiem guanidyny.8 Fibrillogenezę badano w 40 .M .2-mikroglobuliny przy pH 2,5,11 przy pH 7,4 z 20% trifluoroetanolu, 12 i w buforze fosforanowym przy pH 7,4 zi bez nasion preformowanych. Włókna .2-mikroglobuliny i heparyna.13 Włókna scharakteryzowano za pomocą transmisyjnej mikroskopii elektronowej, spolaryzowanej pod mikroskopem optycznym i wiązania 125I-ludzkiego SAP6. Wariant D76N wykrystalizowano, dane rentgenowskie zbierano w rozdzielczości 1,40 A, a trójwymiarowa struktura została rozwiązana w European Synchrotron Radiation Facility.
Wyniki
Funkcje histologiczne
Rozległe złogi amyloidowe znaleziono w śledzionie, wątrobie, sercu, gruczołach ślinowych i nerwach starszej siostry probanda (członek rodziny II-1) w badaniu pośmiertnym
[patrz też: wypuklina krążka międzykręgowego leczenie, niedodma płuc leczenie, stomatologia ursynów ]

Powiązane tematy z artykułem: niedodma płuc leczenie stomatologia ursynów wypuklina krążka międzykręgowego leczenie